Mutacje NPHS2 w późnej fazie ogniskowej segmentowej stwardnienia kłębuszków nerkowych: R229Q jest powszechnym allelem związanym z chorobą ad

Większość rodzin została potwierdzona po skierowaniu przez nefrologa opiekującego się jednym lub kilkoma członkami rodziny. Autosomalna recesywna transmisja była podtrzymywana przez (a) brak choroby u rodziców dotkniętych osobników, (b) brak transmisji choroby przez wiele pokoleń, oraz (c) występowanie choroby u dwóch lub więcej rodzeństwa w każdej rodzinie. Rozpoznanie FSGS w przypadkach indeksu wykazano histologicznie za pomocą biopsji nerek. Nie uwzględniono rodzin z objawami radiologicznymi, klinicznymi lub histopatologicznymi sugerującymi wtórne formy FSGS. Średni wiek zachorowania dotkniętych chorobą członków tych rodzin wynosił 21,8 lat. Członków rodziny oceniano przez pomiar stężenia kreatyniny w surowicy i wydalanie mikroalbumin w moczu. Następnie przebadaliśmy 91 dorosłych z (sporadycznie) podstawowym FSGS. Świadoma zgoda została uzyskana zgodnie z protokołami zatwierdzonymi przez Komitety ds. Badań Ludzkich odpowiedzialnych instytucji. Analiza sekwencji i analiza segregacji. Genomowy DNA ekstrahowano z krwi obwodowej za pomocą zestawu QIAamp DNA blood kit (QIAGEN Inc., Valencia, California, USA). Startery oligonukleotydowe ośmiu eksonów kodujących NPHS2 zaprojektowano w oparciu o zgłoszoną ludzką sekwencję cDNA NPHS2 (nr dostępu w GenBank NM_014625) i dostępną sekwencję genomową (klon BAC chromosomu Homoa15-545A16, dostępna sekwencja genomowa (GenBank AL160286). (50 ng) poddano 30 -35 cyklom amplifikacji PCR w objętości 25 ul, w tym 10 mM Tris HCl (pH 8,3), 50 mM KCl, 1,5 mM MgCl2, 200 mM dNTP i 0,01 U polimerazy Taq. oczyszczono na żelu, a 2550 ng DNA zsekwencjonowano bezpośrednio z zastosowaniem terminatora barwnika ABI PRISM (Applied Biosystems, Foster City, California, USA) Do sekwencjonowania wykorzystano sekwenator DNA ABI (model 377). Sekwencję oznaczono z obu nici Przeprowadzono analizę mutacji za pomocą denaturującej HPLC (DHPLC) stosując startery zoptymalizowane dla tej technologii: ekson 1, GCAGCGACTCCACAGGGACT i TCCACCTTATCTGACGCCCC, ekson 2, AGAATTGGACCAACAGATGC i AAGTGAGAATGGGCATGGTG, ekson 3, GCCCCCGCCGTCTTATGCCAAGGCCTT TTGAAGAC i GGGTTGAAGAAATTGGCAAGTCAGG; ekson 4, AAGGTGAAACCCAAACAGC i CGGTAGGTAGACCATGGAAA; ekson 5, AGGATTTACCACAGGATTAAGTTGTGCA i TAGCTATGAGCTCCCAAAGGGATGG; ekson 6, TATTATAAATAAGGCACTGTGAAGTTAAATACAAC I CCCCCGCCCGCCAGAATATTTTCCTTTATCATACAG; ekson 7, GAGGCTTGCAAGTCTGTGTGAAAGC i AGGAAGCAAAGGGGAAATGTTCTCC; Exon 8, CGTCCCGCGTGAAGCCTTCAGGGAATGAAGAAC I GCGTCCCGTTCTATGGCAGGCCCCTTTACAGTC. DNA amplifikowany przez PCR analizowano pod kątem zmian sekwencji za pomocą DHPLC (Transgenomic Inc, Omaha, Nebraska, USA), zgodnie z zaleceniami producenta, po określeniu profilu topnienia. Segregację mutacji z chorobą oceniano przez sekwencjonowanie lub trawienie enzymami restrykcyjnymi amplifikowanych za pomocą PCR egzonów od wszystkich dostępnych członków rodziny. Trawienie ClaI produktów PCR egzon 5 (545 pz) zwykle daje dwa fragmenty o długości 364 i 181 pz. Mutację R229Q (przejście G. A przy nukleotydzie 755) wykryto przez utratę miejsca trawienia ClaI. Mutacja R291W (przejście C. T przy nukleotydzie 941) stworzyła nowe miejsce trawienia PflMI i została wykryta przez trawienie PflMI produktów eksonu 7 PCR (283 bp) na dwa fragmenty (155 i 128 pz). Mutacyjna analiza transkryptu. RNA ekstrahowano z limfocytów obwodowych za pomocą odczynnika Trizol i poddano odwrotnej transkrypcji losowym starterem heksamerowym przy użyciu zestawu SuperScript (Invitrogen Corp., Carlsbad, California, USA). Startery ATAGATGCCATTTGCTACTACCG i ACAGCCAGTGAGTGCTGAAG, pochodzące z egzonów 5 i 7 NPHS2, zaprojektowano do amplifikacji amplikonu 274 bp z transkryptu NPHS2 zawierającego sekwencję kodującą R229. Zamplifikowany produkt RT-PCR. Z limfocytów od dwóch osobników kontrolnych (bez wariantu DNA R229Q) i dwóch osobników heterozygotycznych względem R229Q strawiono ClaI i analizowano za pomocą elektroforezy w żelu agarozowym. Analiza genotypowa. Genotypowaliśmy członków rodziny przy użyciu znanych markerów chromosomowych 1q (D1S2883, D1S2640, D1S215 i D1S2751), jak również markerów sąsiadujących z locus genu NPHS2 ostatnio opisanego przez Boute i in. (9) (D1S3760 i D1S3758). Znaleźliśmy dodatkowe markery powtórzenia CA, przeszukując sekwencję genomową w pobliżu NPHS2, opublikowaną przez Sanger Institute (http://www.sanger.ac.uk/HGP/Chr1). CA126 znaleziono w sekwencji BAC (GenBank AL160286) i amplifikowano przy użyciu starterów 5a-TTTCATAACTACTTAATGCTGGCAGGC-3. (sens) i 5. -GGTACACTGGATACAACCCAATTGATA-3. (antysensowny). CA1419 znaleziono w BAC RP11-177A2 (GenBank AL139132) i zamplifikowano metodą PCR przy użyciu oligonukleotydów 5a-CGGATTATATTTTTTAGGTCCAGGATTTC-3. (sens) i 5. -CCTCTCAGCCAAGGAATTCAAAATAGC-3. (antysensowny)
[przypisy: dom zdrojowy szczawno zdrój, eve online trial, rezonans magnetyczny kościerzyna ]
[więcej w: gatunek tłustego śledzia, inteligencja interpersonalna, polskie produkty spożywcze ]